Figure 3

Suppression of HIV-1 gene expression and virus production by gRNA/Cas9. (A, B) Effects of gRNA/Cas9 on GFP expression. JLat10.6 cells were transfected with gRNA and hCas9 plasmid DNA using Neon (Life Technologies). TNF-α (10 ng/ml) was added 16 hours after to stimulate HIV-1 gene expression from HIV-1 LTR promoter, which was monitored by flow cytometry. A gRNA targeting the GFP DNA (called T GFP (GTGAACCGCATCGAGCTGAA)) was included as a positive control. The gRNA targeting renilla luciferase DNA (called T RL (GTAGCGCGGTGTATTATACC)) was utilized as a negative control. Results obtained with the empty gRNA vector were arbitrarily set as 100%. The results shown are the average of three independent transfection experiments. Experiments were also performed with gRNA alone (without Cas9) and the results are shown in (B). (C, D) Effects of gRNA/Cas9 on virus production. Levels of viruses in the supernatants were determined by ELISA that measures HIV-1 p24 antigen. Results of three independent transfections are shown. (D) represents the results of experiments performed with gRNA alone (without Cas9). (E, F) Pretreatment with TNF-α does not increase the inhibition of HIV-1 by gRNA/Cas9. JLat10.6 cells were treated with TNF-α (10 ng/ml) for 16 hours before nucleotransfection with gRNA and hCas9 plasmid DNA. GFP-positive cells were scored by flow cytometry and the results are shown in (E). Levels of viruses in the supernatants were determined by HIV-1 p24 ELISA and the results shown in (F). Results are the average of three independent transfections. (G, H) Suppression of HIV-1 by multiple gRNAs that target different HIV-1 DNA sites. Three different gRNAs were co-transfected with hCas9 plasmid DNA. HIV-1 gene expression (shown in (G)) and virus production (shown in (H)) after TNF-α treatment were measured as described above. Results shown are the average of three independent transfection experiments. Asterisks indicate P < 0.05 (Mann–Whitney U test, SPSS 16.0).