Figure 1

Schematic diagram of the RAKE assay. A) The DNA oligonucleotide probe for miRNA detection is composed of three elements. The 5' linker region contains a constant nucleotide sequence (5'GTCGTGACTGGGAATAGCCTG3') with an amine-modified 5'end which permits the probe to conjugate efficiently to the epoxy-coated microarray glass slide. The anti-miRNA region contains a sequence complementary to specific miRNA (for instance, anti-hsa-let-7a 5'AACTATACAACCTACTACCTCA3') for capturing the cognate miRNA (hsa-let-7a 5'UGAGGUAGUAGGUUGUAUAGUU3'). The poly-thymidine region acts as a template for primer extension of the hybridized miRNA using biotinylated-dATP. B) Small RNAs isolated from cells are hybridized to the microarray slide described in A. After washing, unhybridized single-stranded DNA probes (ssDNA probes) are removed by exonuclease I. Digested nucleotides are then removed leaving the hybridized miRNAs for primer extension. The poly-thymidine region now acts as a template for the hybridized miRNA to be extended using Klenow (3'→5' exo^-) in the presence of biotinylated-dATP. Streptavidin-Alexa fluor 555 is then used to bind the biotin group permitting the fluorescent detection of hybridized miRNAs using a GenePix 4000B microarray scanner (Axon/Molecular Dynamics).